Gene-tools Standard Control oligo

Our standard control oligo is a negative control Morpholino oligo that targets a human beta-globin intron mutation that causes beta-thalassemia. This oligo causes little change in phenotype in any known test system except human beta-thalessemic hematopoetic cells; it has been broadly used as a negative control. In a microarray study comparing gene modulation of the standard control oligo with the 25-N random control oligo mixture, the standard control showed more RNA modulation in a zebrafish embryo than did the random control (Gene Tools and Phalanx Biotech Group, unpublished collaboration).

If you want to order more than 300 nmol of a standard control it is less expensive to place an order for a new custom oligo using the standard control sequence than it is to buy multiple prepared control oligos on this page.
 

Product Name: Standard Control oligo
Summary Description: Negative control oligo
Antisense Sequence: CCTCTTACCTCAGTTACAATTTATA